\
>>> from cogent.align.algorithm import nw_align
>>> seq1 = 'AKSAMITNY'
>>> seq2 = 'AKHSAMMIT'
>>> print nw_align(seq1,seq2)
('AK-SAM-ITNY', 'AKHSAMMIT--')
We import useful functions and then load the sequences to be aligned.
>>> from cogent import LoadSeqs, LoadTree, DNA
>>> seqs = LoadSeqs('data/test2.fasta', aligned=False, moltype=DNA)
We load a canned nucleotide substitution model and the progressive aligner TreeAlign function.
>>> from cogent.evolve.models import HKY85
>>> from cogent.align.progressive import TreeAlign
We first align without providing a guide tree. The TreeAlign algorithm builds pairwise alignments and estimates the substitution model parameters and pairwise distances. The distances are used to build a neighbour joining tree and the median value of substitution model parameters are provided to the substitution model for the progressive alignment step.
>>> aln, tree = TreeAlign(HKY85(), seqs)
Param Estimate Summary Stats: kappa
==============================
Statistic Value
------------------------------
Count 10
Sum 1e+06
Median 4.256
Mean 1e+05
StandardDeviation 3.162e+05
Variance 1e+11
------------------------------
>>> aln
5 x 60 text alignment: Human[GCAAGGAGCCA...], HowlerMon[GCAAGGAGCCA...], NineBande[-C-----GCCA...], ...
We then align using a guide tree (pre-estimated) and specifying the ratio of transitions to transversions (kappa).
>>> tree = LoadTree(treestring='(((NineBande:0.0128202449453,Mouse:0.184732725695):0.0289459522137,DogFaced:0.0456427810916):0.0271363715538,Human:0.0341320714654,HowlerMon:0.0188456837006)root;')
>>> params={'kappa': 4.0}
>>> aln, tree = TreeAlign(HKY85(), seqs, tree=tree, param_vals=params)
>>> aln
5 x 60 text alignment: NineBande[-C-----GCCA...], Mouse[GCAGTGAGCCA...], DogFaced[GCAAGGAGCCA...], ...
We load a canned codon substitution model and use a pre-defined tree and parameter estimates.
>>> from cogent.evolve.models import MG94HKY
>>> tree = LoadTree(treestring='((NineBande:0.0575781680031,Mouse:0.594704139406):0.078919659556,DogFaced:0.142151930069,(HowlerMon:0.0619991555435,Human:0.10343006422):0.0792423439112)')
>>> params={'kappa': 4.0, 'omega': 1.3}
>>> aln, tree = TreeAlign(MG94HKY(), seqs, tree=tree, param_vals=params)
>>> aln
5 x 60 text alignment: NineBande[------CGCCA...], Mouse[GCAGTGAGCCA...], DogFaced[GCAAGGAGCCA...], ...
See Using alignment application controllers to align unaligned sequences.
We load some unaligned DNA sequences and show their translation.
>>> from cogent import LoadSeqs, DNA, PROTEIN
>>> seqs = [('hum', 'AAGCAGATCCAGGAAAGCAGCGAGAATGGCAGCCTGGCCGCGCGCCAGGAGAGGCAGGCCCAGGTCAACCTCACT'),
... ('mus', 'AAGCAGATCCAGGAGAGCGGCGAGAGCGGCAGCCTGGCCGCGCGGCAGGAGAGGCAGGCCCAAGTCAACCTCACG'),
... ('rat', 'CTGAACAAGCAGCCACTTTCAAACAAGAAA')]
>>> unaligned_DNA = LoadSeqs(data=seqs, moltype = DNA, aligned = False)
>>> print unaligned_DNA.toFasta()
>hum
AAGCAGATCCAGGAAAGCAGCGAGAATGGCAGCCTGGCCGCGCGCCAGGAGAGGCAGGCCCAGGTCAACCTCACT
>mus
AAGCAGATCCAGGAGAGCGGCGAGAGCGGCAGCCTGGCCGCGCGGCAGGAGAGGCAGGCCCAAGTCAACCTCACG
>rat
CTGAACAAGCAGCCACTTTCAAACAAGAAA
>>> print unaligned_DNA.getTranslation()
>hum
KQIQESSENGSLAARQERQAQVNLT
>mus
KQIQESGESGSLAARQERQAQVNLT
>rat
LNKQPLSNKK
We load an alignment of these protein sequences.
>>> aligned_aa_seqs = [('hum', 'KQIQESSENGSLAARQERQAQVNLT'),
... ('mus', 'KQIQESGESGSLAARQERQAQVNLT'),
... ('rat', 'LNKQ------PLS---------NKK')]
>>> aligned_aa = LoadSeqs(data = aligned_aa_seqs, moltype = PROTEIN)
We then obtain an alignment of the DNA sequences from the alignment of their translation.
>>> aligned_DNA = aligned_aa.replaceSeqs(unaligned_DNA)
>>> print aligned_DNA
>hum
AAGCAGATCCAGGAAAGCAGCGAGAATGGCAGCCTGGCCGCGCGCCAGGAGAGGCAGGCCCAGGTCAACCTCACT
>mus
AAGCAGATCCAGGAGAGCGGCGAGAGCGGCAGCCTGGCCGCGCGGCAGGAGAGGCAGGCCCAAGTCAACCTCACG
>rat
CTGAACAAGCAG------------------CCACTTTCA---------------------------AACAAGAAA